Characteristics of Sensitive HIS1 Genes to the 4-HPPD Inhibiting Rice Herbicides Isolated from Several Rice Cultivars
  • Characteristics of Sensitive HIS1 Genes to the 4-HPPD Inhibiting Rice Herbicides Isolated from Several Rice Cultivars
  • Sang-Su Kim , Jae-Eup Park , Ye-Jin Kim , Yong-Hwan Lee , In-Yong Lee , Jeongran Lee , Byeng-Chul Moon , Yang-Bin Ihm
  • Weed & Turfgrass Science.2016. Dec, 5(4): 187-190
    DOI : http://dx.doi.org/10.5660/WTS.2016.5.4.187

  • Weed&Turfgrass Science was renamed from both formerly Korean Journal of Weed Science from Volume 32 (3), 2012, and formerly Korean Journal of Turgrass from Volume 25 (1), 2011 and Asian Journal of Turgrass Science from Volume 26 (2), 2012 which were launched by The Korean Society of Weed Science and the Turfgrass Society of Korea founded in 1981 and 1987, respectively.
  • Copyright @ 2016, The Korean Society of Weed Science and The Turfgrass Society of Korea Archive
  • This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Download

> Archive > Volume 5(4) > research-article

Abstract
This study was conducted to determine phytotoxicity of domestic rice varieties and characteristic of sensitive gene involved in herbicide reaction of 4-HPPD (4-hydroxy phenylpyruvate dioxygenase) inhibiting herbicides. The five rice varieties were grown for 2 to 3 leaf stage on seedling trays and then transplanted into plastic pot: 4-Japonica type (Sangjubyeo, Sambaekbyeo, Sanduljinmi and Kumyoung) varieties and 1-Indica type variety (IR8). We trialled standard (14 g a.i. 10 a -1 ) and double fold (28 g a.i. 10 a -1 ) dose of benzobicyclon treatment at 10 days after transplanting in order to investigate phytoxicity. The Japonica-type Sangjubyeo showed no rice injury but Indica-type IR8 show 4-5 (standard) and 5-6 (double fold) phytoxicity levels. In spite of Japonica-type, Sanduljinmi and kumyoung showed 3-4 and 4-5 levels. Target resistant gene, Hydroxyphenylpyruvate dioxygenase inhibitor sensitive gene No.1 (HIS1) have been isolated from five domestic rice cultivars (Sangjubyeo, Sambaekbyeo, Sanduljinmi, Kumyoung and IR8). Results of the sequence through PCR, all five tested rice cultivars had HIS1 gene regardless to rice cultivars. And the difference between rice varieties from sequence of HIS1 were identified some variation in genes.
Keywords
서 론
국내 논잡초 발생양상은 1998년 서산 간척지에서 우점하는 논잡초 물옥잠이 설포닐우레아계 제초제에 저항성 잡초로 밝혀 지면서 새로운 전기를 맞이하였다. 논 잡초에 저약량으로 고활성을 보였든 설포닐우레아계 제초제는 국내 논잡초 방제용으로 지속적으로 사용해온 결과 고약량에서도 방제가 되지 않는 제초제 저항성잡초도 급속히 증가하였다. 우리나라에서 현재 설포닐우레아계 제초제에 저항성을 보이는 논잡초는 물달개비와 올챙이고랭이 등 16종이 보고되어 있다( Lee et al., 2013 ).
이러한 설포닐우레아계 저항성잡초를 방제할 수 있는 효과적인 제초제가 4-Hydroxyphenylpyruvate dioxygenase(이하 4-HPPD)를 저해한 제초제(이하 4-HPPD저해 제초제)가 개발 보급되어 저항성 잡초를 효율적으로 방제할 수 있었다( Sekino et al., 2008 ). 현재 국내 등록되어 사용중인 4-HPPD저해 제초제 성분은 benzobicyclone, mesotrione, tefuryltrione이 단제 및 혼합제로 다양하게 개발되어 벼 어린모 초중기 및 중기에 사용되고 있다. 이 성분의 작용기작은 식물의 4-HPPD효소저해로 티로신 대사경로의 플라스토퀴논이 장애를 받아 간접적으로 카로티노이드 생합성경로의 PDS (phytoene desaturase step) 효소에 영향을 주어 카로틴 형성이 억제되고 엽록소붕괴가 일어나 식물체가 백화증상의 약해반응이 나타난다( Barta and Boger, 1996 ; Lee et al., 1997 ; Sekino et al., 2002 ; Sekino et al., 2008 ).
약제처리에 의한 식물의 백화증상은 잡초방제효과를 보이지만 벼에는 일종의 약해증상으로 나타난다. 지금까지 보고된 4-HPPD계 제초제에 의한 벼 약해발생은 일반계인 Japonica 품종에서는 나타나지 않고 통일형인 Indica 품종에서 나타나는 것으로 보고되어 있다. 특히 찰벼 등 기능성 벼 품종에도 백화 증상의 약해가 발생하는 것으로 알려져 있다. 벼의 약해증상은 처리 후 5일경부터 발생하여 7일경에 가장 심하고 그 이후부터 차츰 회복되는 경향을 보이는 것으로 알려져 있다( Kwon et al., 2012 ; Han et al., 2009 ; Kim et al., 2010 ).
벼와 밀에 4-HPPD저해 제초제에 감수성 유전자인 Hydroxy-phenylpyruvate dioxygenase inhibitor sensitive gene No.1(이하 HIS1) 가 존재한다고 알려져 있는데 이 유전자에 의해서 약제반응이 달리 나타난다고 알려져 있어( Barta and Boger, 1996 ), 국내에서 재배되고 있는 몇 가지 벼 품종으로부터 HIS1유전자를 분리하고 이들 유전자의 특성조사가 필요하다.
따라서 본 시험에서는 4-HPPD계 제초제 의한 벼 품종간 약제반응 차이가 상이하므로 작용기작 구명차원에서 4-HPPD계 제초제에 감수성인 벼의 HIS1 유전자를 품종간 비교분석 하였다.
재료 및 방법
4-HPPD저해 제초제에 반응하는 벼 유전자인 Hydroxyphenylpyruvate dioxygenase inhibitor sensitive gene No.1(이하 HIS1)를 분리하고 특성을 조사하기 위해 사용한 벼 품종은 Table 1 과 같다. 동 약제에 저항성 품종인 상주벼와 약제처리로 심한 백화증상을 보이는 일반형 벼 품종인 삼백벼 등 3품종 및 통일형 벼 품종으로 통일계 품종의 교배모본인 IR8 품종을 농촌진흥청 작물시험장으로부터 분양 받아 시험에 사용하였다.
Rice variety used in experiment.
No Rice cultivar Remarks
1 SangJubyeo Japonica rice variety
2 Sambaekbyeo Japonica rice variety
3 Sanduljinmi Japonica rice variety
4 Kumyoung Japonica rice variety
5 IR-8 Indica Rice variety
벼 품종별 약제반응을 조사하기 위해서 전북 완주군 소재 국립농업과학원 온실에서 플라스틱 사각 포트 (48·38·20 cm)에 논토양(식양토)을 곤죽하여 충진하고, 벼 품종별 2~3엽기 유모를 이식하였으며, 이식 10일후에 benzobicyclon 3.5% 액상수화제를 기준량(14 g a.i. 10a -1 ) 및 배량(28 g a.i. 10a -1 ) 처리하였다. 약해조사 시기는 약제처리 10 및 15일후에 실시하였으며 백화증상 등 약해를 달관 조사하였다(약해 정도: 0-9).
4-HPPD 저해 제초제에 민감히 반응하는 벼 유전자인 HIS1의 세부 유전자 특성은 Table 2 와 같다 ( SDS Biotech, 2014 ).
HIS1 primer information from rice varieties (Public patent number 10-2014-0008322).
No. primer name sequence PCR size
1 HIS_ex1_F CTAGCTCCCCAAGTCGAAAC 300
HIS_ex1_R ATGGGGTGAACTCACATGG
2 HIS_ex2_F GCAGGCTATAGATGAGCTGAAA 300
HIS_ex2_R CAGGAAGAAGCCCCAATTCT
3 HIS_ex3_F CTTACCAACCATGGAGTAGAAGC 250
HIS_ex3_R TGAAAGATTCAGGATGGTCAG
4 HIS_ex4_F GTTCTGAACAAGTATGCATCAGGA 250
HIS_ex4_R GGTGTCACCTAAGTTGATCAGCAAT
5 HIS_ex5_F GGGTTTCTGAATGCTGATGC 700
HIS_ex5_R TGCCTTGAAACGTGAGAACG
6 HIS_ex4-half_F TGTTGTCTGAATTCAGAAAGTAC 200
HIS_ex4-half_R TCCTCATCAAGCTCAAGAAGC
시험에 사용된 5품종의 종자를 이용하여 gDNA (genomic DNA)를 추출 (DNeasy Plant mini kit(QIAgen Cat.no 69104)) 하였으며 Table 2 와 같은 PCR primer를 각 품종 당 적용하였고, 이는 HIS1의 Exon1, Exon2, Exon3, Exon4 (전반부위), Exon4 (후반부위), Exon5 (전반부위) 등 총 6 set로 PCR 조건을 확립하였다. 염기서열분석은 ABI PRISM 3730XL Analyzer (96 capillary type) with BigDye(R) Terminator v3.1 장비를 통해 진행되었다 (Taq pol.: Dr. MAX DNA Polymerase, cat.no.:DR00302).
Sequencing 산출물인 fasta 형식의 기초 데이터를 이용하여 기존에 알려진 HIS1 유전자 서열과 비교한 후, 유전자 유무와 유전자적 일치도를 확인하였다 (SNP analysis : Variant report V 1.0 (Applied Biosystems).
결과 및 고찰
본 시험에 사용된 5개 벼 품종을 대상으로 4-HPPD저해 제초제인 benzobicyclon 액상수화제를 기준량과 배량을 처리하여 약제반응을 조사한 결과 Table 3 과 같이 Japonica 품종인 상주벼에는 백화증상의 약해증상이 발생하지 않았으며, Japonica 품종임에도 불구하고 삼백벼에서는 기준량에서는 2-3, 배량에서는 3-4의 백화증상의 약해가 발생하였으며, 산들진미, 금영 품종에서는 3-4 및 4-5의 약해증상을 보였다. 또한 Indica 품종인 IR-8 품종에서는 기준량에서 3~5, 배량에서는 4~6의 가증 심한 약해증상을 보였다 ( Table 3 ). 4-HPPD저해 제초제에 대한 벼 약해시험은 Kwon et al. (2012)과 Kim et al. (2010)은 4-HPPD저해 제초제에 의한 통일계통의 초다수성 벼와 찰벼 등 기능성 벼에서 심한 약해가 발생하는 것으로 보고한바 있고, 본시험에서도 동일한 결과를 보였으나, 일반계인 삼백벼, 산들진미, 금영 품종에서 약해가 발생하는 것은 생태형이 더 이상 HPPD 제초제의 약해 판단 기준이 될 수 없음을 보여주는 결과로 판단된다. 이러한 결과는 삼백벼의 경우 Koshihikari/YR2406-2-1-1//Hokuriku115/Cheolweon29의 교배조합인데 이 중 치악벼(Cheolweon29)의 교배조합(Josaengtongil/Kuiku90)에 통일벼가 사용되어 그 약해 요인이 유전되어 나타나는 것으로 추정되며, 마찬가지로 산들진미와 금영은 공통적으로 삼백벼가 교배모본으로 사용되었다. 따라서, 유전적 요인에 따른 HPPD의 약해 판단기준이 필요할 것으로 사료된다.
Visual phytotoxicity according to concentration of 4-HPPD inhibiting herbicide, benzobicyclon, in rice cultivars.
No. Rice cultivar Visual phytotoxicity according toherbicide concentration (0-9)
Standard Two fold
1 SangJubyeo 0 0
2 Sambaekbyeo 2-3 3-4
3 Sanduljinmi 3-4 4-5
4 Kumyoung 3-4 4-5
5 IR-8 4-5 5-6
PCR 결과는 Fig. 1 과 같이 5품종 당 각 6 set로 진행되었으며 해당 PCR 결과물의 size가 Table 2 와 동일함을 확인하였다. 따라서 시험에 사용된 전체 벼 품종에서 HIS1 유전자가 존재함을 확인할 수 있었다.
PPT Slide
Lager Image
Gene amplication of HIS1 gene in rice cultivars by PCR. Lane 1, 7, 13, 19, 25: HIS_ex1_F/HIS_ex1_R(300bp); Lane 2, 8, 14, 20, 26: HIS_ex2_F/HIS_ex2_R(300bp); Lane 3, 9, 15, 21, 27: HIS_ex3_F/HIS_ex3_R(250bp); Lane 4, 10, 16, 22, 28: HIS_ex4_F/HIS_ex4_R(250bp); Lane 5, 11, 17, 23, 29: HIS_ex5_F/HIS_ex5_R(700bp); Lane 6, 12, 18, 24, 30: HIS_ex4-half_F/ HIS_ex4-half_R(200bp)
Sequencing 산출물인 fasta 형식의 기초데이터를 이용하여 기존에 알려진 HIS1 유전자 서열 (Reference: AK065581.1 BAG89569.1)과 비교한 후, 유전자 유무와 유전자적 일치도를 확인하였다 ( Fig. 2 ). 그 결과 5 품종의 각 6 set의 PCR 산출물의 염기서열이 기존에 알려진 HIS1 유전자 서열과 99% 이상 일치하여 매우 유사함을 확인할 수 있었다(그림에서 노란색으로 표기된 부분이 동일함을 나타냄). 몇 품종에서 기존 HIS1 유전자염기서열과 차이가 나는 SNP가 확인되었으며 녹색 박스로 표기하였다(삽입은 보라색, 결실은 빨간색으로 표기됨).
PPT Slide
Lager Image
Multiple alignment of PCR products. a The name of rice cultivar(IR-8: IR8; KY: Kumyoung; SB: Sambaegbyeo; SDJM: Sandeuljinmi; SJ: Sangjubyeo).
결론적으로 Table 2 와 같이 유전자 특허 공개번호 10-2014-0008322 정보에 따라 4-HPPD 저해 제초제 저항성 유전자로 밝혀진 HIS1은 국내 벼 5품종에는 판별 유전자로 대표 할 수 없는 것으로 최종 확인하였다. 이와 같은 결과는 기존에 보고된 4-HPPD저해 제초제와 HIS1유전자가 친화적인 관계라는 연구결과( Barta and Boger, 1996 )와 정반대 되는 결과여서 추가적인 작용기작 연구가 필요할 것으로 사료된다.
References
Akasaka M. , Watanabe H. , Kawana Y. 2011 Inheritance for sensitivity of high-yielding rice cultivars, ‘Momiroman’ and ‘Takanari’, to benzobicyclon, a 4—HPPD inhibitor J. Weed Sci. Tech. 56 (2) 89 - 94
Barta I.C. , Boger P. 1996 Purification and characterization of 4-hydroxyphenyl pyruvate dioxygenase from maize Pestic. Sci. 48 109 - 116
Han S.S. , Yoo K.Y. , Park M.S. , Kang D.W. 2009 Reactivity of herbicide benzobicyclon in rice and weed rice Kor. J. Weed Sci. 29 (2) 105 -
Kim S.Y. , Lee J.Y. , Yeo U.S. , Oh S.H. , Park S.T. 2010 Differential tolerance of rice cultivars to mesotrione-contained herbicides Kor. J. Weed Sci. 30 (3) 300 - 307
Kwon O.D. , Shin S.H. , An K.N. , Lee Y. , Min H.K. 2012 Response of phytotoxicity on Rice varieties to HPPD-inhibiting herbicides in paddy rice fields Kor. J. Weed Sci. 32 (3) 240 - 255
Lee D.L. , Prisbylla M.P. , Cromatie T.H. , Dagarin D.P. , Howard S.W. 1997 The discovery of P-hydroxyphenylpyruvate dioxygenase Weed Sci. 45 601 - 609
Lee I.Y. , Won T.J. , Seo Y.H. , Kim E.J. , Yun Y.T. 2013 Occurrence trends of SU-herbicide resistant weeds in paddy fields in Korea Weed Turf. Sci. 2 (3) 318 - 321
SDS Biotech, K.K. 2014 Plant having improved resistivity or sensitivity to 4-HPPD inhibitor Korea 10-2014-0008322
Sekino K. 2002 Discovery study of new herbicides from the inhibition of photosynthetic pigments biosynthesis (development of a new plastoquinone biosynthetic inhibitor, benzobicyclon as a herbicide) Japanese J. Weed Sci. 27 388 - 391
Sekino K. , Koyanagi H. , Ikuta E. , Yamada Y. 2008 Herbicidal activity of a new paddy bleaching herbicide, benzobicyclon J. Pestic. Sci. 33 364 - 370